VIRsiRNAid | siRNA Sequence | Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
virsi1250 | cugugacauuggagaguca | West Nile Virus [WNV] | NS5 | BHK-21 | Cell Count | 100 | 21423625 | Blast SL | refseqs |       |
virsi1230 | ugcucugugacauuggaga | West Nile Virus [WNV] | NS5 | BHK-21 | Cell Count | 95 | 21423625 | Blast SL | refseqs |       |
virsi1225 | ugcucugugacauuggaga | St. Louis Encephalitis [SLE] | NS5 | BHK-21 | Cell Count | 85 | 21423625 | Blast SL | refseqs |       |
virsi1227 | cugugacauuggagaguca | St. Louis Encephalitis [SLE] | NS5 | BHK-21 | Cell Count | 83 | 21423625 | Blast SL | refseqs |       |
virsi1489 | gcuaaggugcuugagcugc | West Nile Virus [WNV] | NS5 | HTB Cells | Cell Count | 30 | 18360908 | Blast SL | refseqs |       |
virsi1233 | ucugugacauuggagaguc | West Nile Virus [WNV] | NS5 | BHK-21 | Cell Count | 26 | 21423625 | Blast SL | refseqs |       |
virsi1229 | gcucugugacauuggagag | West Nile Virus [WNV] | NS5 | BHK-21 | Cell Count | 24 | 21423625 | Blast SL | refseqs |       |
virsi1231 | cacaugagauguacugggu | West Nile Virus [WNV] | NS5 | BHK-21 | Cell Count | 5 | 21423625 | Blast SL | refseqs |       |
virsi1240 | augcccugaacaccuucac | West Nile Virus [WNV] | NS5 | BHK-21 | Cell Count | 5 | 21423625 | Blast SL | refseqs |       |
virsi1490 | gaaccgucauggauguuau | West Nile Virus [WNV] | NS5 | HTB Cells | Cell Count | 0 | 18360908 | Blast SL | refseqs |       |
virsi2205 | agagccauuugguucaugu | West Nile Virus [WNV] | NS5 | Vero | mRNA | 75 | 19135091 | Blast SL | refseqs |       |
virsi2324 | ggauggagcuugagagaaa | Dengue Virus [DENV] | NS5 | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |       | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2326 | ccaaagagguaguggacaa | Dengue Virus [DENV] | NS5 | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |       | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2327 | gaggaaugcuugugagaaa | Dengue Virus [DENV] | NS5 | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |       | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2328 | ggauggagccuuagagaaa | Dengue Virus [DENV] | NS5 | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |       | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2329 | ccaaagagguaguggacaa | Dengue Virus [DENV] | NS5 | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |       | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2305 | ggaccgacauuguggaggu | Yellow Fever Virus | NS5 | Vero E6 | Plaque Count | 29 | 19169857 | Blast SL | refseqs |       |
virsi2306 | aggagguuuggcggaacag | Yellow Fever Virus | NS5 | Vero E6 | Plaque Count | 12 | 19169857 | Blast SL | refseqs |       |
virsi2330 | ggauggagcuuaagagaaa | Dengue Virus [DENV] | NS5 | Huh-7 | Plaque Count | 0 | 21795337 | Blast SL | refseqs |       | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi1106 | gaagaacgcuguaguggau | West Nile Virus [WNV] | NS5 | Huh-7 .5 | Protein | Low | 15985182 | Blast SL | refseqs |       |
virsi1107 | ggacgcaccuugggagaggu | West Nile Virus [WNV] | NS5 | Huh-7 .5 | Protein | Low | 15985182 | Blast SL | refseqs |       |
virsi1108 | ggucaacagcaaugcagcu | West Nile Virus [WNV] | NS5 | Huh-7 .5 | Protein | Low | 15985182 | Blast SL | refseqs |       |
virsi1109 | cagcaaugcagcuuugggu | West Nile Virus [WNV] | NS5 | Huh-7 .5 | Protein | Low | 15985182 | Blast SL | refseqs |       |
virsi1110 | gaagcagagccauuugguu | West Nile Virus [WNV] | NS5 | Huh-7 .5 | Protein | Low | 15985182 | Blast SL | refseqs |       |
virsi1111 | gggaaaggacccaaaguca | West Nile Virus [WNV] | NS5 | Huh-7 .5 | Protein | Low | 15985182 | Blast SL | refseqs |       |